Applied Bioinformatics Course [中文] [博士班]

Pairwise sequence alignment

Use Needle and Water to align the following sequence pairs with different scoring matrix and gap penalty, compare the results:

• 'AFATCAT" and 'AFASTCAT'
• 'THEFASTCATCATCHESAFATRAT' and 'THEFATCATCATCHESADEADRAT'
• 'AREALFRIENDISAFRIENDINNEED' and 'AFRIENDINNEEDISAFRIENDINDEED'

Use Needle to align the following three sequences between each other, make a summary of your analysis results with Table 1 of ABC Example

• The protein sequence of human, mouse and rat hemoglobin alpha chain: HBA_HUMAN, HBA_MOUSE, HBA_RAT
• The coding sequence of human, mouse and rat hemoglobin alpha chain: HSHBA1_CDS, MMHBA-A1_CDS, RNHBA1_CDS

Use Needle and Water to align the following sequence pairs with different scoring matrix and gap penalty, compare the results:

• Human hemoglobin alpha chain HBA_HUMAN and human hemoglobin beta chain HBB_HUMAN
• Human hemoglobin alpha chain HBA_HUMAN and human myoglobin MYG_HUMAN
• Human hemoglobin alpha chain HBA_HUMAN and human cytoglobin CYGB_HUMAN
• Human hemoglobin alpha chain HBA_HUMAN and human neuroglobin NGB_HUMAN
• Human hemoglobin alpha chain HBA_HUMAN and yellow lupine leg hemoglobin LGB2_LUPLU
• Pokeweed antimicrobial protein 1DKC and Huwen spider toxin 1QK6
• Funnel web spider toxin 1EIT and Huwen spider toxin 1QK6
• Human saliadase 2 (PDB: 1VCU) NEUR2_HUMAN and Influenza virus neuraminidase N2 (PDB 2BAT) NRAM_I67A0
• Arabidopsis SBP transcription factor SPL3_ARATH and SPL4_ARATH
• Arabidopsis SBP transcription factor SPL3_ARATH and SPL14_ARATH
• Pisum sativum post-floral specific protein 1 PPF1_PEA and Arabidopsis inner membrane protein ALBINO3 ALB3_ARATH
• The coding sequence encoding PPF1_PEA Y12618_CDS and Arabidopsis ALBINO3 NM_128439_CDS
• The full length mRNA sequence for PPF1_PEA Y12618 and Arabidopsis ALBINO3 NM_128439
• The human type 5 carcinoembryonic antigen CEAM5_HUMAN and the mouse type 1 carcinoembryonic antigen CEAM1_MOUSE with gap extention 2.
• The human type 3 carcinoembryonic antigen CEAM3_HUMAN and the human type 7 carcinoembryonic antigen CEAM7_HUMAN
• The human type 3 carcinoembryonic antigen CEAM3_HUMAN and the human type 5 carcinoembryonic antigen CEAM5_HUMAN
• The rice histidine transporter Q85V22_ORYSI and the Arabidopsis lysine and histidine transporter LHT1_ARATH

Multiple sequence alignment

• Make multiple sequence alignment for the protein sequence of hemoglobin alpha chain from 7 vertebrates 7HBA
• Make multiple sequence alignment for the protein sequence of 12 human globins 12 Globins
• Make multiple sequence alignment for the protein sequence of 15 Arabidopsis SBP transcription factors 15 ATSBP, use different programs (ClustalW, TCoffee and Dialign) and compare the results.
• Make multiple sequence alignment for the whole length sequence of 12 Human CEA antigens 12 Human CEA
• Make multiple sequence alignment for the N-terminal domain of 8 Human CEA antigens 8 Human CEA N domain
• Make multiple sequence alignment for 9 peptides: 9CRP use manual editing to align three disulfide bonds.

Dotplot

DNA and protein sequence comparison using the dot plot approach.

• Draw a dotplot for a test DNA sequence (ACGTACCAGTACGTATAGTGACGTACCAGTACGTATAGTG) with a tandem repeat, use different word size and compare the results
• Draw a dotplot for a test protein sequence (SENESCENSE), use different word size and compare the results
• Draw a dotplot for the fugu cosmid sequence (AF164138.FAS)
• Retrieve similar regions from AF164138.FAS and draw a dotplot
• Find similar domains from human and mouse carcinoembryonic antigen (CEAM5_HUMAN.FAS, CEAM1_MOUSE.FAS)
• Find the repeat domains from human type 5 carcinoembryonic antigen (CEAM5_HUMAN.FAS)
• Find out the sequence pattern of the drosophila slit protein sequence (SLIT_DROME.FAS) with the online Dotlet web server or the EMBOSS dotmatcher program
• Find the zinc proteinase domain between human MS2 cell surface antigen (ADAM8_HUMAN.FAS) and adamalysin II (VM1A2_CROAD.FAS) from Crotalus adamanteus (Eastern diamondback rattlesnake) venom
• Find special sequence feature of serine-repeat antigen protein precursor (SERA_PLAFG.FAS) using dotplot
• Find special sequence feature of serine/threonine-protein kinase ifkA from Dictyostelium discoideum (IFKA_DICDI.FAS) using dotplot
• Find the special sequence feature of human zinc finger protein (ZN492_HUMAN.FAS)
• Find the special sequence feature of human ubiquitin C (NP_066289.FAS) using dotplot